In the next few days, Yang Zhou finally completed the experimental plan and produced 1,000 improved carrot seeds.

In fact, these seeds cannot get infinitely large and colorful carrots, and in the past week or so, Yang Zhou has not been able to isolate the corresponding gene sequences found in the simulation experiment in the laboratory.

If the genes are numbered according to the gene sequence, the genes that Yang Zhou wants to lock are the 23141 number and the 12304 number base pair.

In reality, these two genes have not been found at all, of course, these two genes must exist in the carrot gene, but it is very difficult to find.

Fortunately, the extracted gene sequences are extremely similar, so Yang Zhou took a shortcut.

He replaced the carrot seeds, which were very similar to the real world and the simulated experiments.

Case No. 656 and Case No. 893 were eventually seeded in Mystic Space.

Among them, No. 656 freezes the carotene conversion gene in carrots.

It is equivalent to the carrot grown, but in fact, there is no carotene, and it can only be used to satisfy hunger at most.

The conversion of carotene will allow plant cells to supply a large amount of nutrients to produce carotene, and after carrots do not have carotene, nutrient accumulation will cause the appearance of carrots to increase, and the specific size is related to nutrition and cell division speed.

There are many papers on making fruits bigger, and the most famous of them is tomatoes.

Wild tomatoes are the size of a finger, and there are now cherry tomato varieties that produce many small tomatoes.

But scientists have sequenced the genes of tomatoes in their entirety and found many phenomena.

For example, the fruit size of a tomato is determined by the number of carpels of a flower, and the number of carpels determines the number of seed chambers, which eventually become part of the fruit.

Eventually, the scientists used the same technology now as Yang Zhou to isolate a protein (a transcription factor that binds to a specific DNA sequence) involved in ENO growth using CRISPR-Cas9 editing technology.

THIS ALLOWED THEM TO SEE THAT ENO IS A FRUIT REGULATOR CAPABLE OF LIMITING STEM CELL PRODUCTION IN FLOWERS BY REGULATING WUSCHEL (A SIGNALING PATHWAY) GENE EXPRESSION.

The result is a variety of tomatoes that are larger than a fist.

Therefore, Yang Zhou's paper will not seem magical, but a technology that humans have long used in plants.

The difficulty is that Yang Zhou found the carrot ENO fruit regulator, which is the first case in the world.

Now the technology of infinite growth of carrots can continue to be optimized, which requires the adjustment of more genes, and not just freezing a certain gene, but using gene editing technology to transfer genes from other species to carrots, which involves transgenic technology.

Due to the general rejection of genetically modified technology in society, Yang Zhou does not plan to turn the first improved variety into genetically modified carrots.

The principle of genetically modified carrots is also very simple, for example, if you see that the volume of winter melon is very large, you can extract the fruit gene of winter melon and embed it in the carrot gene with technology.

Genetically modified soybeans can not be afraid of glyphosate, which is the principle used.

Changing the color of carrots is easier than changing the size, because there are countless varieties of carrots.

Some radishes are cyan, some are pink, and some are pure white, orange-red, and so on.

What determines the color of a carrot is the pigment genes contained in the carrot genes.

Pigment genes basically exist in all carrot varieties, just like computers have a lot of codes, but some codes exist in computers, but they are not usually used, when carrots do not use any color codes, they appear as white radish.

When the anthocyanin genetic code is present, it takes on the appearance of a carrot.

When chlorophyll appears, it turns cyan.

Yang Zhou also found in the simulation experiments in his mind that there are countless kinds of carotene pigments at the genetic level, which means that carrots may have colorful characteristics in their most primitive state.

But as the plant evolved, carrots formed separate varieties of various colors.

The genes that control the carrot pigment are like a switch that determines whether the carrot will eventually grow into a white, carrot, or green radish.

Of course, yellow, bright red and other colors of radish can also be transformed, and even mixed color radishes.

This requires precise control of the order of the base macromolecules, and the gene expression is written into the genetic factors.

In reality, there is no such technology, which involves genetic programming.

In fact, the more he understands the microcosm of biology, Yang Zhou finds that almost all the current technology of human beings is imitating biology.

In other words, biological evolution is the origin of technology.

The changes within the cell are far more complex than all the machines that exist today.

Take programming as an example, computers in the physical world use the 01 base system, and rely on electronic blocking to achieve 01 transformation and create computers.

The genes of living things also have codes, which are the 4 forms of base pairs.

The beams connected in the double helix structure are really just abstract concepts, and the reality is that they are all individual base molecules.

Among them, there are 4 kinds of base macromolecules, namely A-adenine, G-guanine, T-thymine, C-cytosine, and U-uracil.

Strictly speaking, a base pair is a pair of bases that match each other (i.e., A—T, G—C, A—U interactions) that are linked together by hydrogen bonds.

It's like 01/10/001/1000 and so on in code, which is binary in the computer and 4 in the biological gene sequence.

Whether it's AT/GC/AU/or GA/UC, etc., it's all code.

When using CRISPR-Cas9 technology, you usually talk to the lab that makes Cas9 and they will give you a website where you can edit the genetic code you want online.

The final form of the edit is a bunch of atggccatctacaagcagtcacagcacatgacggaggttgtgaggcgctgcccccaccatgagcgctgctcagatagcgatg.

This code is a piece of the human body's genetic sequence.

Many years ago, human beings have completed the sequencing of the human genome, and the genetic code of the human body can also be queried on the Internet, but although they know the code, scientists still do not know what the specific expression of this string of codes is.

It's like the person who wrote the program encapsulating it, and it would be very difficult for others to crack it.

At present, human beings have a certain understanding of human genes.

For example, if it is known which people are susceptible to cancer, the probability of developing cancer will increase as long as the cancer gene is detected in the genes.

So cancer is actually hereditary, but most people's cancer genes are not activated.

The actress who filmed Tomb Raider found out that she had a breast cancer gene during genetic testing, so she simply cut off the big baby whole.

Of course, this is a bit extreme, even if you don't cut it, you don't necessarily get cancer, but the probability will be relatively large.

Yang Zhou's long-term goal is naturally to figure out the meaning of the genetic code.

Figuring out the meaning of the gene code could theoretically enable any form of gene editing.

Even if you let plants survive in the ocean, it's very simple.

That is, the genetic code of seaweed plants in the ocean is edited into the genetic sequence of terrestrial plants, and then the survival of terrestrial plants in the ocean can be improved.