The time soon came to September 5th, a few days ago, the university opened, students from all over the world came to the school like tired birds, and the campus of Qingbei University was also lively.

From time to time, world-renowned scholars give public lectures at the school, and some videos are posted on the Internet, which can be the envy of students in other schools.

Originally, Liao Mingchu wanted to suppress the heat and let everyone not pay too much attention to the results of the "Global Gene Code Academic Forum", and countless media reporters flocked to the forum.

Yang Zhou's technique has been on the news for 30 points, and in everyone's opinion, it must be the best technology.

Now that foreign scholars are coming, it is an opportunity for a long face, and I must have a good interview.

Liao Mingchu was the coordinator of this academic conference, and many reporters contacted him to shoot the whole process, but he refused, and some reporters who knew more came up with why Wang Bingbing could be interviewed, and they couldn't question it.

Is it looking down on reporters outside CCTV?

In the future, they will not serve the news related to Qingbei University.

The pressure on his head was increasing, and Liao Mingchu finally asked Yang Zhou if he would like to let reporters attend the discussion.

Liao Mingchu has already decided to take the last option.

That is, if it is questioned, and even global scholars do not admit it, they will take the route of academic controversy.

Shinichi Mochizuki, a footbasin mathematician at the time, came out with his 512-page paper after years of retreat and said that he had solved the world's top mathematical problem of the ABC conjecture, which had plagued the academic community for many years.

At first, it was also denied by everyone.

Because others couldn't understand what he was writing, the paper used a lot of mathematical tools of his own invention.

The theory of far-abelian geometry is also used.

It was created in the 80s by Pope Grothendieck of algebraic geometry to study the structural similarity of the basic groups of algebraic clusters on different geometric objects.

The most important thing is that this far-reaching "Far Abelian Geometry" paper is more than 700 pages long, and no more than 50 people in the world can read it.

In order to understand Shinichi Mochizuki's thesis, you must first learn far Abel geometry, and then understand Shinichi Mochizuki's own "Intercosmic Teichmüller Theory". And then there's the mystical terms he defined that had never been seen before, such as "Hodge Theater" and "alien arithmetic holomorphic structures."

Unless it is an obvious loophole in academics, if the author proposes a paper that everyone does not understand, but says that it is "right", everyone can deny the paper, but everyone cannot say that the paper is wrong, and the author can still stick to his theory.

If you deny, you must always understand the other party's research and ideas, so in Liao Mingchu's view, Yang Zhou's situation can still be saved.

Yang Zhou proposed the theory of gene code, and many scientists around the world denied this theory, but Yang Zhou relied on this theory to study the mutant carrot.

As for the mutant rice, Liao Mingchu has ignored it.

Yang Zhou did not report the germination of rice seeds separately, and was ready to surprise the dean and tutor at the academic conference, he brought a USB flash drive, which stored the photos of rice germination and experimental data.

In Liao Mingchu's office, Yang Zhou is receiving detailed guidance from Dean Liao.

For example, if a certain point of view is questioned, how should it be responded to, and how should it be recognized by everyone, so that everyone can also participate in the study of genetic code.

As long as everyone studies genetic code, Yang Zhou's title of founding sect will be occupied.

"Dean, don't worry, I'm ready, I'm not afraid of being questioned, and when I was writing a book on genetic code recently, I also put together a paper, which I can show to you at the symposium this time, and then submit it to the journal." Yang Zhou took out a thick document from his schoolbag and said.

As long as academic papers are published at open academic seminars, they have a first-mover advantage.

For example, in the midst of academic competition, one party is too late to publish a journal, you can participate in a world-renowned academic forum, and announce your research at the forum has the same effect as publishing a paper in a journal.

Of course, the scale of this forum must be large, and the forum held by Qingbei University now has enough influence.

When Liao Mingchu heard that there was a new paper, he suddenly felt a little big, and he complained a little: "Why didn't you say it earlier, what you prepared before was the paper on Nature, and now you take out the new paper, and you have to arrange someone to print it quickly, and are you sure that this paper is okay?" If you are caught red-handed and make mistakes and omissions, there are media reporters at the scene, and you will be embarrassed at that time. ”

"Hehe, there are no experimental instruments for them to verify, what I write, to them, is a book of heaven, what do they question me?" Yang Zhou said with a smile.

Liao Mingchu flipped through the new paper written by Yang Zhou, titled "The Internal Association of Carrot and Hybrid Rice Genetic Code and Basic Research on Gene Code", which was full of a large number of atggccatctacaagcagtcacagcacatgacggaggttgtgaggcgctgcccccaccatgagcgctcagatagcga.

A few days ago, the data collected by the postdoctoral fellows, as well as the data obtained from Yang Zhou's previous experiments, were used in this paper.

After a few glances, Liao Mingchu felt dazzled.

The genetic code is simply indecipherable to the naked eye.

This is not calculated by the computer, and I can't see anything at all, at most I can study the basic logic in the paper.

After reading it, Liao Mingchu thought for a while before nodding and said: "Okay, then use you, I, a biologist, can't understand what you are studying, the threshold of this genetic code is really a bit high!" ”

Liao Mingchu is a top biologist in China, and he is not bad compared to some big bulls abroad, he can't understand it, and others are estimated to be the same.

In this case, it made Liao Mingchu a little happy.

Originally, I heard the news that Zhang Feng was going to question Yang Zhou's previous paper, and now Yang Zhou took out a new paper to discuss, so how could others question it.

"Good job, you young people are open-minded, hahaha, I'm going to get people to print documents." Liao Mingchu patted Yang Zhou's shoulder and left with a smile.

The conversation between the two has actually been filmed by documentaries.

Since more than half a month ago, most of Yang Zhou's life outside the hotel room has been recorded, and finally Wang Bingbing selects some material clips every day and sends them to his video account, and the rest of the materials are sorted out and archived, and when the time is right, it will be edited into a documentary.

Yang Zhou's participation in this academic symposium on genetic code is the focus of the documentary, and Wang Bingbing has already called other colleagues to arrange it in the school auditorium in advance.

Unlike the usual single camera, this time there will be several cameras.

It was the first time she had conducted such a large scene.

"Yang Zhou, you are very confident today, can you deal with it?" Wang Bingbing asked.

"Don't worry, didn't you shoot the whole thing, our seeds have sprouted." Yang Zhou said with a smile.

Wang Bingbing rolled her eyes, she graduated from liberal arts, and although she followed the whole process these days, she couldn't understand it at all.

Before he could say a few words, Tang Yue was already shouting outside: "Yang Zhou, the principal wants to see you." ”

The meeting officially started in the afternoon, a total of four hours, after the end of the school to arrange a buffet dinner, this day Yang Zhou felt that everyone was busy, worried, nervous, he was still relatively calm.

Death has to be faced every day, what else is there to be afraid of in this world.

It is estimated that the principal has no bottom in his heart, and he wants to be at ease in advance, Yang Zhou responded and rushed to the principal's office with the filming team.